Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGL3-Basic-hCYP26A1P-E4-mCherry
(Plasmid #135478)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135478 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL3-Basic-luciferase
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 4818
  • Total vector size (bp) 5842
  • Modifications to backbone
    The mCherry ORF DNA fragment was amplified by PCR and subjected to TA cloning into the pGEM-T Easy vector. An isolated clone was sequenced for confirmation and then double digested with NcoI/XbaI for obtaining the mCherry fragment insert. For construction of pGL3-Basic-hCYP26A1P-mCherry (E4.2) clone containing the human CYP26A1 promoter, the pGL3-Basic-hCYP26A1P-E4 Luciferase was first double digested with NcoI/XbaI to remove luciferase DNA fragment and then replaced with mCherry.
  • Vector type
    Unspecified
  • Selectable markers
    None

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Follow the protocol from Promega.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mCherry Open reading Frame
  • Alt name
    Red Fluorescent Protein
  • Insert Size (bp)
    713
  • Promoter Short from promoter of human CYP26A1 (312 bp)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer AACCATGGTGAGCAAGGGCGAGG
  • 3′ sequencing primer AATCTAGATTACTTGTACAGCTCGTCCATG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL3-Basic-hCYP26A1P-E4-mCherry was a gift from Catharine Ross (Addgene plasmid # 135478 ; http://n2t.net/addgene:135478 ; RRID:Addgene_135478)
  • For your References section:

    CYP26A1 gene promoter is a useful tool for reporting RAR-mediated retinoid activity. Zolfaghari R, Mattie FJ, Wei CH, Chisholm DR, Whiting A, Ross AC. Anal Biochem. 2019 Jul 15;577:98-109. doi: 10.1016/j.ab.2019.04.022. Epub 2019 Apr 27. 10.1016/j.ab.2019.04.022 PubMed 31039331