Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCDF11-SFPQ(276-535)
(Plasmid #135436)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135436 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCDF11
  • Backbone manufacturer
    EMBL
  • Backbone size w/o insert (bp) 3584
  • Total vector size (bp) 4368
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    splicing factor proline and glutamine rich
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    800
  • GenBank ID
    NM_005066.3 6421
  • Entrez Gene
    SFPQ (a.k.a. POMP100, PPP1R140, PSF)
  • Promoter T7
  • Tag / Fusion Protein
    • Hexahistidine (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCDF11-SFPQ(276-535) was a gift from Charles Bond (Addgene plasmid # 135436 ; http://n2t.net/addgene:135436 ; RRID:Addgene_135436)
  • For your References section:

    The structure of human SFPQ reveals a coiled-coil mediated polymer essential for functional aggregation in gene regulation. Lee M, Sadowska A, Bekere I, Ho D, Gully BS, Lu Y, Iyer KS, Trewhella J, Fox AH, Bond CS. Nucleic Acids Res. 2015 Apr 20;43(7):3826-40. doi: 10.1093/nar/gkv156. Epub 2015 Mar 12. 10.1093/nar/gkv156 PubMed 25765647