pCDF11-SFPQ(276-535)
(Plasmid
#135436)
-
PurposeExpresses SFPQ 276-535 with TEV-cleavable hexahistidine tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135436 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCDF11
-
Backbone manufacturerEMBL
- Backbone size w/o insert (bp) 3584
- Total vector size (bp) 4368
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namesplicing factor proline and glutamine rich
-
SpeciesH. sapiens (human)
-
Insert Size (bp)800
-
GenBank IDNM_005066.3 6421
-
Entrez GeneSFPQ (a.k.a. POMP100, PPP1R140, PSF)
- Promoter T7
-
Tag
/ Fusion Protein
- Hexahistidine (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDF11-SFPQ(276-535) was a gift from Charles Bond (Addgene plasmid # 135436 ; http://n2t.net/addgene:135436 ; RRID:Addgene_135436) -
For your References section:
The structure of human SFPQ reveals a coiled-coil mediated polymer essential for functional aggregation in gene regulation. Lee M, Sadowska A, Bekere I, Ho D, Gully BS, Lu Y, Iyer KS, Trewhella J, Fox AH, Bond CS. Nucleic Acids Res. 2015 Apr 20;43(7):3826-40. doi: 10.1093/nar/gkv156. Epub 2015 Mar 12. 10.1093/nar/gkv156 PubMed 25765647