pAAV-hSyn-Flex-Axon-EGFP
(Plasmid #135429)

• Purpose: Can be used to drive axon-enriched expression of EGFP in the presence of Cre recombinase.
• Depositing Lab: Rylan Larsen
• Publication: AAV plasmids for the expression of EGFP (unpublished)

Backbone

• Vector backbone: pAAV-hSyn1-DIO-SSFO-EYFP-P2A-nlsdTomato-WPRE-BGHpA
• Backbone manufacturer: Jonathan Ting
• Total vector size (bp): 5463
• Modifications to backbone: A fragment containing axon-EGFP was swapped in to replace SSFO-EYFP-P2A-nlsdTomato in the backbone. Total AAV packaging size (including ITRs and DNA in between) is 2867 BP.
• Vector type: Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: axon-EGFP
• Alt name: Axon-Enhanced Green Fluorescent Protein
• Species: A. victoria
• Insert Size (bp): 1069
• Promoter: hSyn1
• Tag / Fusion Protein:
  • GAP43 palmitoylation domain (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: AGTCGAGAAACCGGCTAGAG
• 3′ sequencing primer: CCAGAGGTTGATTATCGATA

Resource Information

• Supplemental Documents:
  • pAAV_hSyn1_DIO_Axon-GFP_WPRE_BGHpA_final.gb
• A portion of this plasmid was derived from a plasmid made by: EGFP was synthesized de novo based on sequences published by Stanley Falkow's laboratory (Cormack et al, 1996, Gene). The Axon(Gap43) targeting sequence fused to GFP was previously published by Lin Tian's lab in Broussard et al, 2018 PMID: PMC6697169

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

This plasmid can be used to express Axon-targeted EGFP in neurons that express Cre. It is useful for studies aiming map projections from a given class of Cre-expressing neuron or to image structural axon dynamics.

Information for AAV1 (Catalog # 135429-AAV1)

Purpose

Ready-to-use AAV1 particles produced from pAAV-hSyn-Flex-Axon-EGFP (#135429). In addition to the viral particles, you will also receive purified pAAV-hSyn-Flex-Axon-EGFP plasmid DNA.

Syn-driven, Cre-dependent expression of axon-targeted EGFP control. These AAV preparations are suitable purity for injection into animals.

Delivery

• Volume: 100 µL
• Titer: ≥ 7×10¹² vg/mL
• Pricing: $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
• Storage: Store at -80℃. Thaw just before use and keep on ice.
• Shipment: Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.

Viral Production & Use

• Packaging Plasmids: encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
• Buffer: PBS + 0.001% Poloxamer 188
• Serotype: AAV1
• Purification: Iodixanol gradient ultracentrifugation
• Reporter Gene: EGFP (Cre-dependent)

Biosafety

Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide

Terms and Licenses

• Academic/Nonprofit Terms:
  • Terms of Use for Viral Vectors
• Industry Terms:
  • Not Available to Industry

Viral Quality Control

Quality Control:

• Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
• Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.

Visit our viral production page for more information.

Addgene Comments

Using FLEX vectors in vivo: LoxP sites in FLEX plasmids are known to recombine during DNA amplification and viral vector production, which may result in a minority of Cre-activated (i.e., "flipped") viral vectors. Addgene has measured this occurs in 0.1-0.8% of viral particles in our typical production protocol. This can lead to a small number of cells exhibiting Cre-independent transgene expression in vivo. To address this, it is necessary to optimize the injection volume and viral titer to find the optimal AAV dosage required for Cre-dependent transgene expression and function in vivo. This may include reducing the viral particle dosage in order to reduce the likelihood of Cre-independent expression.