AAV Ef1a-EGFP-WPRE
(Plasmid #135428)

• Purpose: Can be used to express EGFP. Can also be used to create adeno-associated virus for delivery of the EGFP sequence
• Depositing Lab: Rylan Larsen
• Publication: AAV plasmids for the expression of EGFP (unpublished)

Backbone

• Vector backbone: pAAV-EF1a-Flpo
• Backbone manufacturer: Karl Deisseroth
• Backbone size w/o insert (bp): 6109
• Total vector size (bp): 6051
• Modifications to backbone: A fragment containing EGFP was swapped into replace FlpO in the original backbone.
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: EGFP
• Alt name: enhanced green fluorescent protein
• Species: Aequorea victoria
• Insert Size (bp): 739
• Promoter: EF1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pAAV_Efla_EGFP.gb
• A portion of this plasmid was derived from a plasmid made by: EGFP was synthesized de novo based on sequences published by Stanley Falkow's laboratory (Cormack et al, 1996, Gene)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry