Skip to main content
Addgene

AAV Ef1a-mRuby3-WPRE
(Plasmid #135427)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135427 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-EF1a-Flpo
  • Backbone manufacturer
    Karl Deisseroth
  • Backbone size w/o insert (bp) 6109
  • Total vector size (bp) 6042
  • Modifications to backbone
    A fragment containing mRuby3 was swapped into replace FlpO in the original backbone.
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    mRuby3
  • Alt name
    monomeric ruby3
  • Alt name
    mRuby3 red fluorescent protein
  • Species
    Synthetic
  • Insert Size (bp)
    729
  • Promoter Ef1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    mRuby3 was synthesized de novo based on sequences published by Jun Chu's and Michael Lin's laboratories (Bajar et al, 2016, Nature Communications, PMID:26879144) .

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AAV Ef1a-mRuby3-WPRE was a gift from Rylan Larsen (Addgene plasmid # 135427 ; http://n2t.net/addgene:135427 ; RRID:Addgene_135427)