AAV Ef1a-mRuby3-WPRE
(Plasmid #135427)

• Purpose: Can be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.
• Depositing Lab: Rylan Larsen
• Publication: AAV red fluorescent protein plasmids (unpublished)

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-EF1a-Flpo
• Backbone manufacturer: Karl Deisseroth
• Backbone size w/o insert (bp): 6109
• Total vector size (bp): 6042
• Modifications to backbone: A fragment containing mRuby3 was swapped into replace FlpO in the original backbone.
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mRuby3
• Alt name: monomeric ruby3
• Alt name: mRuby3 red fluorescent protein
• Species: Synthetic
• Insert Size (bp): 729
• Promoter: Ef1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pAAV_Ef1a_mRuby3.gb
• A portion of this plasmid was derived from a plasmid made by: mRuby3 was synthesized de novo based on sequences published by Jun Chu's and Michael Lin's laboratories (Bajar et al, 2016, Nature Communications, PMID:26879144) .

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry