AAV Ef1a-mRuby3-WPRE
(Plasmid #135427)

• Purpose: Can be used to express mRuby3. Can also be used to create adeno-associated virus for delivery of the mRuby3 sequence.
• Depositing Lab: Rylan Larsen
• Publication: AAV red fluorescent protein plasmids (unpublished)

Backbone

• Vector backbone: pAAV-EF1a-Flpo
• Backbone manufacturer: Karl Deisseroth
• Backbone size w/o insert (bp): 6109
• Total vector size (bp): 6042
• Modifications to backbone: A fragment containing mRuby3 was swapped into replace FlpO in the original backbone.
• Vector type: Mammalian Expression, AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: mRuby3
• Alt name: monomeric ruby3
• Alt name: mRuby3 red fluorescent protein
• Species: Synthetic
• Insert Size (bp): 729
• Promoter: Ef1a

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: TCAAGCCTCAGACAGTGGTTC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• Supplemental Documents:
  • pAAV_Ef1a_mRuby3.gb
• A portion of this plasmid was derived from a plasmid made by: mRuby3 was synthesized de novo based on sequences published by Jun Chu's and Michael Lin's laboratories (Bajar et al, 2016, Nature Communications, PMID:26879144) .

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry