-
PurposeExpresses TFEB-sfGFP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135402 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMRX-IP
-
Vector typeMammalian Expression, Retroviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameTFEB
-
Alt nameTranscription factor EB
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1428
-
GenBank IDNM_001271945.1
-
Entrez GeneTFEB (a.k.a. ALPHATFEB, BHLHE35, TCFEB)
-
Tag
/ Fusion Protein
- sfGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site NotI (unknown if destroyed)
- 5′ sequencing primer TAACAACTCCGCCCCATTGA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMRX-IP TFEB-sfGFP was a gift from Eisuke Itakura (Addgene plasmid # 135402 ; http://n2t.net/addgene:135402 ; RRID:Addgene_135402) -
For your References section:
Identification of a factor controlling lysosomal homeostasis using a novel lysosomal trafficking probe. Ishii S, Matsuura A, Itakura E. Sci Rep. 2019 Aug 12;9(1):11635. doi: 10.1038/s41598-019-48131-2. 10.1038/s41598-019-48131-2 PubMed 31406169