pcDNA3.1-hRARα
(Plasmid
#135397)
-
PurposeHuman Retinoic Acid Receptor-alpha in pcDNA3.1(+) plasmid expression vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135397 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1(+)
- Backbone size w/o insert (bp) 5428
- Total vector size (bp) 6817
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFollow the protocol from Promega.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHuman retinoic acid receptor-alpha
-
Alt nameRARα
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1389
-
GenBank IDNM_000964
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ATGCTAGCGCCACCATGGCCAGCAACAGCAGC
- 3′ sequencing primer TTAAGCTTCACGGGGAGTGGGTGGC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The human RARα open reading frame PCR amplified DNA was first cloned into pGEMT-Easy vector (Promega) and then subjected to DNA sequencing for confirmation. The isolated plasmid containing the receptor DNA was double digested with NheI/HindIII and subcloned into the pcDNA3.1(+) expression vector.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1-hRARα was a gift from Catharine Ross (Addgene plasmid # 135397 ; http://n2t.net/addgene:135397 ; RRID:Addgene_135397) -
For your References section:
CYP26A1 gene promoter is a useful tool for reporting RAR-mediated retinoid activity. Zolfaghari R, Mattie FJ, Wei CH, Chisholm DR, Whiting A, Ross AC. Anal Biochem. 2019 Jul 15;577:98-109. doi: 10.1016/j.ab.2019.04.022. Epub 2019 Apr 27. 10.1016/j.ab.2019.04.022 PubMed 31039331