Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pcDNA3.1-hRARα
(Plasmid #135397)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135397 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA3.1(+)
  • Backbone size w/o insert (bp) 5428
  • Total vector size (bp) 6817
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Follow the protocol from Promega.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Human retinoic acid receptor-alpha
  • Alt name
    RARα
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1389
  • GenBank ID
    NM_000964
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer ATGCTAGCGCCACCATGGCCAGCAACAGCAGC
  • 3′ sequencing primer TTAAGCTTCACGGGGAGTGGGTGGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The human RARα open reading frame PCR amplified DNA was first cloned into pGEMT-Easy vector (Promega) and then subjected to DNA sequencing for confirmation. The isolated plasmid containing the receptor DNA was double digested with NheI/HindIII and subcloned into the pcDNA3.1(+) expression vector.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA3.1-hRARα was a gift from Catharine Ross (Addgene plasmid # 135397 ; http://n2t.net/addgene:135397 ; RRID:Addgene_135397)
  • For your References section:

    CYP26A1 gene promoter is a useful tool for reporting RAR-mediated retinoid activity. Zolfaghari R, Mattie FJ, Wei CH, Chisholm DR, Whiting A, Ross AC. Anal Biochem. 2019 Jul 15;577:98-109. doi: 10.1016/j.ab.2019.04.022. Epub 2019 Apr 27. 10.1016/j.ab.2019.04.022 PubMed 31039331