Skip to main content
Addgene

gRNA-hIRF-1 #12/pSIR-hCD2
(Plasmid #135392)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135392 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pSIR-hCD2
  • Backbone manufacturer
    Hodaka Fujii
  • Backbone size w/o insert (bp) 8183
  • Total vector size (bp) 8738
  • Vector type
    Mammalian Expression, Retroviral, CRISPR
  • Selectable markers
    human CD2

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA_hIRF1 promoter #12
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    555
  • GenBank ID
    DQ789232.1
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR I (not destroyed)
  • 3′ cloning site EcoR I (not destroyed)
  • 5′ sequencing primer ATACTGGCCGTTCTCCTCTTCTGA
  • 3′ sequencing primer GCGCTTACACTTTAGGAGACACTC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gRNA-hIRF-1 #12/pSIR-hCD2 was a gift from Hodaka Fujii (Addgene plasmid # 135392 ; http://n2t.net/addgene:135392 ; RRID:Addgene_135392)

  • For your References section:

    MSCV-based retroviral plasmids expressing 3xFLAG-Sp-dCas9 for enChIP analysis. Yuno M, Nagata S, Fujita T, Fujii H. Biol Methods Protoc. 2021 Jul 9;6(1):bpab013. doi: 10.1093/biomethods/bpab013. eCollection 2021. 10.1093/biomethods/bpab013 PubMed 34409168
Related items: