MSCV-BCL6-t2A-BCL2
(Plasmid #135305)

• Purpose: Overexpression of multiple human genes (BCL2 and BCL6)
• Depositing Lab: Daniel Hodson
• Publication: Caeser et al Nat Commun. 2019 Oct 4;10(1):4543. doi: 10.1038/s41467-019-12494-x.

Backbone

• Vector backbone: MSCV_IRES_huDC2
• Backbone size w/o insert (bp): 6574
• Total vector size (bp): 9496
• Modifications to backbone: BCL6-t2A-BCL2 were cloned into MSCV_IRES_huDC2 using Gibson Assembly
• Vector type: Retroviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: BCL6
• Species: H. sapiens (human)
• Insert Size (bp): 2118
• GenBank ID: XM_005247694
• Entrez Gene: BCL6 (a.k.a. BCL5, BCL6A, LAZ3, ZBTB27, ZNF51)
• Promoter: LTR

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CCCTTGAACCTCCTCGTTCGACC

Gene/Insert 2

• Gene/Insert name: BCL2
• Species: H. sapiens (human)
• Insert Size (bp): 720
• GenBank ID: NM_000633
• Entrez Gene: BCL2 (a.k.a. Bcl-2, PPP1R50)
• Promoter: LTR

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: AAGCCCTACAAATGCGAAACCTGC

Resource Information

• Articles Citing this Plasmid:
  • 2 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry