pBR322_KanR_AgeI_AvrII_PSE1
(Plasmid
#135229)
-
PurposePSE1 experimental evolution
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135229 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepBR322
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namePSE-1
-
SpeciesPseudomonas aeruginosa
-
Insert Size (bp)813
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (unknown if destroyed)
- 3′ cloning site AvrII (unknown if destroyed)
- 5′ sequencing primer ATGAGTATTCAACATTTCCGTGTCG
- 3′ sequencing primer CTTCACCTAGATCCTTTTAAATTAAAAATGAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBR322_KanR_AgeI_AvrII_PSE1 was a gift from Chris Sander (Addgene plasmid # 135229 ; http://n2t.net/addgene:135229 ; RRID:Addgene_135229) -
For your References section:
Protein Structure from Experimental Evolution. Stiffler MA, Poelwijk FJ, Brock KP, Stein RR, Riesselman A, Teyra J, Sidhu SS, Marks DS, Gauthier NP, Sander C. Cell Syst. 2020 Jan 22;10(1):15-24.e5. doi: 10.1016/j.cels.2019.11.008. Epub 2019 Dec 11. 10.1016/j.cels.2019.11.008 PubMed 31838147