HsTPC2-EYFP
(Plasmid
#135194)
-
PurposeExpresses tagged TPC2 in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135194 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 7000
- Total vector size (bp) 10000
-
Modifications to backboneEYFP replaces EGFP
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTPC2
-
Alt nameTwo-pore channel 2
-
Alt nameTpcn2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2448
-
GenBank IDBC063008
-
Entrez GeneTPCN2 (a.k.a. SHEP10, TPC2)
-
Tag
/ Fusion Protein
- EYFP (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer CAACGGGACTTTCCAAAATG
- 3′ sequencing primer GAAATTTGTGATGCTATTGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySource Bioscience
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
IMAGE clone: 5214862
Collection ID: IRAT 83e4
GeneBank: BC063008
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
HsTPC2-EYFP was a gift from Antony Galione (Addgene plasmid # 135194 ; http://n2t.net/addgene:135194 ; RRID:Addgene_135194) -
For your References section:
NAADP activates two-pore channels on T cell cytolytic granules to stimulate exocytosis and killing. Davis LC, Morgan AJ, Chen JL, Snead CM, Bloor-Young D, Shenderov E, Stanton-Humphreys MN, Conway SJ, Churchill GC, Parrington J, Cerundolo V, Galione A. Curr Biol. 2012 Dec 18;22(24):2331-7. doi: 10.1016/j.cub.2012.10.035. Epub 2012 Nov 21. 10.1016/j.cub.2012.10.035 PubMed 23177477