Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

HsTPC2-EYFP
(Plasmid #135194)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135194 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-N1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 7000
  • Total vector size (bp) 10000
  • Modifications to backbone
    EYFP replaces EGFP
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TPC2
  • Alt name
    Two-pore channel 2
  • Alt name
    Tpcn2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2448
  • GenBank ID
    BC063008
  • Entrez Gene
    TPCN2 (a.k.a. SHEP10, TPC2)
  • Tag / Fusion Protein
    • EYFP (C terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CAACGGGACTTTCCAAAATG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Source Bioscience

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

IMAGE clone: 5214862
Collection ID: IRAT 83e4
GeneBank: BC063008

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HsTPC2-EYFP was a gift from Antony Galione (Addgene plasmid # 135194 ; http://n2t.net/addgene:135194 ; RRID:Addgene_135194)
  • For your References section:

    NAADP activates two-pore channels on T cell cytolytic granules to stimulate exocytosis and killing. Davis LC, Morgan AJ, Chen JL, Snead CM, Bloor-Young D, Shenderov E, Stanton-Humphreys MN, Conway SJ, Churchill GC, Parrington J, Cerundolo V, Galione A. Curr Biol. 2012 Dec 18;22(24):2331-7. doi: 10.1016/j.cub.2012.10.035. Epub 2012 Nov 21. 10.1016/j.cub.2012.10.035 PubMed 23177477