TRPML1-mCherry
(Plasmid #135189)

• Purpose: Expresses TRPML1 with C-terminus mCherry tag in mammalian cells.
• Depositing Lab: Antony Galione
• Publication: Ruas et al EMBO J. 2015 Jul 2;34(13):1743-58. doi: 10.15252/embj.201490009. Epub 2015 Apr 14.

Backbone

• Vector backbone: pLVXpuro
• Backbone size w/o insert (bp): 8080
• Total vector size (bp): 10537
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TRPML1
• Alt name: Mcoln1
• Species: M. musculus (mouse)
• GenBank ID: BC005651
• Entrez Gene: Mcoln1 (a.k.a. 2210015I05Rik, TRPML1, mucolipidin)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CAACGGGACTTTCCAAAATG
• 3′ sequencing primer: CCAGAGGCCACTTGTGTAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Source Bioscience

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

I.M.A.G.E. Fully Sequenced cDNA Clone IRAKp961C166Q