TPC2(N257A)-mCherry
(Plasmid #135186)

• Purpose: Pore-dead mutant of TPC2, tagged on C terminus with mCherry.
• Depositing Lab: Antony Galione
• Publication: Ruas et al EMBO J. 2015 Jul 2;34(13):1743-58. doi: 10.15252/embj.201490009. Epub 2015 Apr 14.

Backbone

• Vector backbone: pLVXpuro
• Backbone size w/o insert (bp): 8080
• Total vector size (bp): 10990
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TPC2
• Alt name: Two-pore channel 2
• Alt name: Tpcn2
• Species: M. musculus (mouse)
• Insert Size (bp): 2193
• Mutation: Mutation of asparagine257 to alanine
• GenBank ID: BC141195
• Entrez Gene: Tpcn2 (a.k.a. D830047E22Rik, Gm35086)
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CAACGGGACTTTCCAAAATG
• 3′ sequencing primer: CCAGAGGCCACTTGTGTAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Unknown

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

IMAGE clone: 9055807
ImaGenes collection: IRCKp5014F1215Q
GeneBank: BC141195