Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pmCherry-SopF
(Plasmid #135174)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135174 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pmCherry-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4722
  • Total vector size (bp) 5844
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SopF
  • Species
    Salmonella enterica serovar Typhimurium
  • Insert Size (bp)
    1125
  • Entrez Gene
    STM1239 (a.k.a. STM1239)
  • Tag / Fusion Protein
    • mCherry (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site SalI (unknown if destroyed)
  • 5′ sequencing primer pmCherryC1-F (5' GTTGGACATCACCTCCCACAACGAG 3')
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pmCherry-SopF was a gift from Leigh Knodler (Addgene plasmid # 135174 ; http://n2t.net/addgene:135174 ; RRID:Addgene_135174)
  • For your References section:

    SopF, a phosphoinositide binding effector, promotes the stability of the nascent Salmonella-containing vacuole. Lau N, Haeberle AL, O'Keeffe BJ, Latomanski EA, Celli J, Newton HJ, Knodler LA. PLoS Pathog. 2019 Jul 24;15(7):e1007959. doi: 10.1371/journal.ppat.1007959. eCollection 2019 Jul. 10.1371/journal.ppat.1007959 PubMed 31339948