3xIRS luciferase
(Plasmid #13511)

• Depositing Lab: Kunliang Guan
• Publication: Tang et al J Biol Chem. 1999 Jun 11. 274(24):16741-6.

Backbone

• Vector backbone: pGL2-Promoter
• Backbone manufacturer: Promega
• Backbone size w/o insert (bp): 5800
• Vector type: Mammalian Expression, Luciferase

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 3xIRS
• Alt name: Insulin-responsive sequence
• Species: H. sapiens (human)
• Insert Size (bp): 150
• Entrez Gene: IGFBP1 (a.k.a. AFBP, IBP1, IGF-BP25, PP12, hIGFBP-1)
• Tag / Fusion Protein:
  • luciferase (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (destroyed during cloning)
• 3′ cloning site: XhoI (destroyed during cloning)
• 5′ sequencing primer: EBV rev primer
• 3′ sequencing primer: LucNrev primer

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Two oligonucleotides (GCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAAGCAAAACAAACTTATTTTGAA and TCGATTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCTTCAAAATAAGTTTGTTTTGCGTAC) were annealed together and ligated into the pGL2-Promoter vector (Promega) to create 3×IRS-luciferase. The IRS sequences were derived from human IGFBP-1's IRS.

See "Author's Map" for more information.