Skip to main content
Addgene

pcDNA5FRTTO-codoptUL33-CStHA
(Plasmid #135106)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135106 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA5/FRT/TO/CStHA
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HSV-1 UL33 codon optimized
  • Species
    Synthetic; Herpes Simplex Virus 1
  • Tag / Fusion Protein
    • Strep-Strep-HA (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGGCT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA5FRTTO-codoptUL33-CStHA was a gift from Markus Landthaler (Addgene plasmid # 135106 ; http://n2t.net/addgene:135106 ; RRID:Addgene_135106)
  • For your References section:

    Single-cell RNA-sequencing of herpes simplex virus 1-infected cells connects NRF2 activation to an antiviral program. Wyler E, Franke V, Menegatti J, Kocks C, Boltengagen A, Praktiknjo S, Walch-Ruckheim B, Bosse J, Rajewsky N, Grasser F, Akalin A, Landthaler M. Nat Commun. 2019 Oct 25;10(1):4878. doi: 10.1038/s41467-019-12894-z. 10.1038/s41467-019-12894-z PubMed 31653857