pcDNA5FRTTO-NHASt-codoptUL33
(Plasmid
#135103)
-
PurposeCodon-optimized HSV-1 UL33 with N-terminal HAStrep tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135103 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA5/FRT/TO/NHASt
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHSV-1 UL33 codon optimized
-
SpeciesSynthetic; Herpes Simplex Virus 1
-
Tag
/ Fusion Protein
- HA-Strep-Strep (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGGCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA5FRTTO-NHASt-codoptUL33 was a gift from Markus Landthaler (Addgene plasmid # 135103 ; http://n2t.net/addgene:135103 ; RRID:Addgene_135103) -
For your References section:
Single-cell RNA-sequencing of herpes simplex virus 1-infected cells connects NRF2 activation to an antiviral program. Wyler E, Franke V, Menegatti J, Kocks C, Boltengagen A, Praktiknjo S, Walch-Ruckheim B, Bosse J, Rajewsky N, Grasser F, Akalin A, Landthaler M. Nat Commun. 2019 Oct 25;10(1):4878. doi: 10.1038/s41467-019-12894-z. 10.1038/s41467-019-12894-z PubMed 31653857