Skip to main content
Addgene

pCZGY2729
(Plasmid #135096)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135096 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pCFJ201
  • Backbone size w/o insert (bp) 7654
  • Total vector size (bp) 12520
  • Modifications to backbone
    Replacement of Punc-119 driven unc-119 with hygromycin resistance driven by a ubiquitous promoter.
  • Vector type
    Worm Expression, CRISPR
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Hygromycin resistance
  • Promoter rps-0

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer ggaacaaaggagttcagatcctgtg
  • 3′ sequencing primer AGCCAGTCTGCAGGTCGACC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCZGY2729 was a gift from Yishi Jin (Addgene plasmid # 135096 ; http://n2t.net/addgene:135096 ; RRID:Addgene_135096)

  • For your References section:

    Inhibition of Axon Regeneration by Liquid-like TIAR-2 Granules. Andrusiak MG, Sharifnia P, Lyu X, Wang Z, Dickey AM, Wu Z, Chisholm AD, Jin Y. Neuron. 2019 Jul 24. pii: S0896-6273(19)30602-6. doi: 10.1016/j.neuron.2019.07.004. 10.1016/j.neuron.2019.07.004 PubMed 31378567
Related items:
Commonly requested with: