Myo 1b-myc
(Plasmid #135064)

• Purpose: Expression of rat Myo 1b (Myr 1) in mammalian cells. C-terminal myc-tag.
• Depositing Lab: Martin Bähler
• Publication: Ruppert et al J Cell Biol. 1993 Mar;120(6):1393-403. doi: 10.1083/jcb.120.6.1393.

Backbone

• Vector backbone: pCMV5
• Backbone manufacturer: Dr. David Russell, UTSW
• Backbone size w/o insert (bp): 4603
• Total vector size (bp): 8200
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Myo 1b with 5' UTR
• Alt name: Myr 1
• Species: R. norvegicus (rat)
• Insert Size (bp): 3600
• GenBank ID: X68199
• Entrez Gene: Myo1b (a.k.a. Myr1)
• Promoter: CMV
• Tags / Fusion Proteins:
  • Linker (C terminal on insert)
  • Myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Eco RI (not destroyed)
• 3′ cloning site: Xba I (not destroyed)
• 5′ sequencing primer: CMV-F CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: hGH-PA-R CCAGCTTGGTTCCCAATAGA

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Myr 1 has three alternative spliceforms. In this plasmid spliceform Myr 1b is cloned, that exhibits a deletion of 29 amino acids.
The size of the 5' UTR is unknown, therefore the Insert size is estimated.
See also :
Ruppert C, Godel J, Muller RT, Kroschewski R, Reinhard J, Bahler M
J Cell Sci. 1995 Dec;108 ( Pt 12):3775-86. PubMed