CMV-eGFP-Z1
(Plasmid #135049)

• Purpose: Enhanced Green fluorescent protein expression for mammalian cells under constitutive CMV Promoter in minimal backbone plasmid.
• Depositing Lab: Jordan Green
• Publication: Constitutive promoter minimal backbone plasmids for optimized expression in mammalian cells (unpublished)

Backbone

• Vector backbone: Z1
• Backbone manufacturer: Green Lab
• Backbone size w/o insert (bp): 2226
• Total vector size (bp): 2946
• Vector type: Mammalian Expression, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Bleocin (Zeocin), 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: eGFP
• Alt name: Enhanced Green Fluorescent Protein
• Species: Synthetic
• Insert Size (bp): 720
• Promoter: CMV Promoter

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: KpnI (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: cgcaaatgggcggtaggcgtg
• 3′ sequencing primer: cacgcctaccgcccatttgcg

Resource Information

• Supplemental Documents:
  • CMV-eGFP-Z1.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry