CMV-AausFP1-Z1
(Plasmid
#135048)
-
PurposeAausFP1 - bright green fluorescent protein expression from A. australis under CMV promoter in minimal backbone plasmid.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135048 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneEF1a-AausFP1-Z1
- Backbone size w/o insert (bp) 2225
- Total vector size (bp) 2930
-
Vector typeMammalian Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Bleocin (Zeocin), 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAausFP1
-
Alt nameA. australis fluorescent protein 1
-
SpeciesSynthetic
-
Insert Size (bp)705
- Promoter CMV Promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer cacgcctaccgcccatttgcg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CMV-AausFP1-Z1 was a gift from Jordan Green (Addgene plasmid # 135048 ; http://n2t.net/addgene:135048 ; RRID:Addgene_135048)