pU6-(BsaI)_CBh-UN-Cas9-T2A-mCherry
(Plasmid #135013)

• Purpose: Expression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 with 126aa MRN-recruiting domain from HSV-1 UL12 fused to N-terminus of Cas9, linked to mCherry via a T2A peptide
• Depositing Lab: Yosef Shaul
• Publication: Reuven et al Biomolecules. 2019 Oct 8;9(10). pii: biom9100584. doi: 10.3390/biom9100584.

Backbone

• Vector backbone: pU6-(BbsI)_CBh-Cas9-T2A-mCherry (Addgene 64324), modification of pX330 (Addgene 42230)
• Backbone manufacturer: Kuehn lab
• Total vector size (bp): 9673
• Modifications to backbone: Sites for cloning sgRNAs changed to BsaI. Sticky ends for cloning sgRNAs are the same as the original parent vectors. 126aa domain from HSV-1 UL12 fused to N-terminus of Flag-Cas9
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: humanized S. pyogenes Cas9
• Alt name: SpCas9
• Alt name: hSpCas9
• Species: humanized S. pyogenes
• Insert Size (bp): 4272
• Mutation: 126aa domain from HSV-1 UL12 fused to the N-terminus of Flag-Cas9
• Promoter: CBh
• Tags / Fusion Proteins:
  • 3xFLAG (N terminal on insert) (N terminal on insert)
  • 3x Flag (N terminal on insert)
  • NLS (N terminal on insert)
  • NLS (C terminal on insert)
  • T2A-mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI/SgrAI (AgeI not destroyed) (not destroyed)
• 3′ cloning site: NcoI/BspHI (destroyed during cloning)
• 5′ sequencing primer: agggatggttggttggtggg

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The UL12 fragment was pcr amplified from the pSAK UL12/12.5 plasmid from Sandra K. Weller's laboratory, University of Connecticut Health Center
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry