Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pU6-(BsaI)_CBh-UN-Cas9-T2A-mCherry
(Plasmid #135013)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 135013 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pU6-(BbsI)_CBh-Cas9-T2A-mCherry (Addgene 64324), modification of pX330 (Addgene 42230)
  • Backbone manufacturer
    Kuehn lab
  • Total vector size (bp) 9673
  • Modifications to backbone
    Sites for cloning sgRNAs changed to BsaI. Sticky ends for cloning sgRNAs are the same as the original parent vectors. 126aa domain from HSV-1 UL12 fused to N-terminus of Flag-Cas9
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    humanized S. pyogenes Cas9
  • Alt name
    SpCas9
  • Alt name
    hSpCas9
  • Species
    humanized S. pyogenes
  • Insert Size (bp)
    4272
  • Mutation
    126aa domain from HSV-1 UL12 fused to the N-terminus of Flag-Cas9
  • Promoter CBh
  • Tags / Fusion Proteins
    • 3xFLAG (N terminal on insert) (N terminal on insert)
    • 3x Flag (N terminal on insert)
    • NLS (N terminal on insert)
    • NLS (C terminal on insert)
    • T2A-mCherry (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI/SgrAI (AgeI not destroyed) (not destroyed)
  • 3′ cloning site NcoI/BspHI (destroyed during cloning)
  • 5′ sequencing primer agggatggttggttggtggg
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The UL12 fragment was pcr amplified from the pSAK UL12/12.5 plasmid from Sandra K. Weller's laboratory, University of Connecticut Health Center
  • Article Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pU6-(BsaI)_CBh-UN-Cas9-T2A-mCherry was a gift from Yosef Shaul (Addgene plasmid # 135013 ; http://n2t.net/addgene:135013 ; RRID:Addgene_135013)
  • For your References section:

    Recruitment of DNA Repair MRN Complex by Intrinsically Disordered Protein Domain Fused to Cas9 Improves Efficiency of CRISPR-Mediated Genome Editing. Reuven N, Adler J, Broennimann K, Myers N, Shaul Y. Biomolecules. 2019 Oct 8;9(10). pii: biom9100584. doi: 10.3390/biom9100584. 10.3390/biom9100584 PubMed 31597252