pU6-(BsaI)_CBh-Cas9
(Plasmid
#135010)
-
PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 135010 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330
-
Backbone manufacturerZhang lab (Addgene plasmid # 42230)
- Backbone size w/o insert (bp) 8508
- Total vector size (bp) 8508
-
Modifications to backboneSites for cloning sgRNA changed to BsaI. Sticky ends for cloning of sgRNA are the same as the original pX330 vector
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehumanized S. pyogenes Cas9
-
Alt nameSpCas9
-
Alt namehSpCas9
-
Specieshumanized S. pyogenes
-
Insert Size (bp)4272
- Promoter CBh
-
Tag
/ Fusion Protein
- 3xFLAG (N terminal on insert) (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed) (not destroyed)
- 3′ cloning site EcoRI (not destroyed) (not destroyed)
- 5′ sequencing primer agggatggttggttggtggg
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBased on pX330 (Addgene plasmid 42230)
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pU6-(BsaI)_CBh-Cas9 was a gift from Yosef Shaul (Addgene plasmid # 135010 ; http://n2t.net/addgene:135010 ; RRID:Addgene_135010) -
For your References section:
Recruitment of DNA Repair MRN Complex by Intrinsically Disordered Protein Domain Fused to Cas9 Improves Efficiency of CRISPR-Mediated Genome Editing. Reuven N, Adler J, Broennimann K, Myers N, Shaul Y. Biomolecules. 2019 Oct 8;9(10). pii: biom9100584. doi: 10.3390/biom9100584. 10.3390/biom9100584 PubMed 31597252