pU6-(BsaI)_CBh-Cas9
(Plasmid #135010)

• Purpose: Expression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9
• Depositing Lab: Yosef Shaul
• Publication: Reuven et al Biomolecules. 2019 Oct 8;9(10). pii: biom9100584. doi: 10.3390/biom9100584.

Backbone

• Vector backbone: pX330
• Backbone manufacturer: Zhang lab (Addgene plasmid # 42230)
• Backbone size w/o insert (bp): 8508
• Total vector size (bp): 8508
• Modifications to backbone: Sites for cloning sgRNA changed to BsaI. Sticky ends for cloning of sgRNA are the same as the original pX330 vector
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: humanized S. pyogenes Cas9
• Alt name: SpCas9
• Alt name: hSpCas9
• Species: humanized S. pyogenes
• Insert Size (bp): 4272
• Promoter: CBh
• Tag / Fusion Protein:
  • 3xFLAG (N terminal on insert) (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed) (not destroyed)
• 3′ cloning site: EcoRI (not destroyed) (not destroyed)
• 5′ sequencing primer: agggatggttggttggtggg
• 3′ sequencing primer: CCAATCCTCCCCCTTGCTGT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: Based on pX330 (Addgene plasmid 42230)
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry