Skip to main content
Addgene

GFP-Myo 1g
(Plasmid #134991)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134991 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4701
  • Total vector size (bp) 7782
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Myo 1g
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    3081
  • Entrez Gene
    Myo1g (a.k.a. E430002D17Rik)
  • Promoter CMV IE
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Bgl II (not destroyed)
  • 3′ cloning site Sal I (not destroyed)
  • 5′ sequencing primer EGFP-C CATGGTCCTGCTGGAGTTCGTG
  • 3′ sequencing primer SV40pA-R GAAATTTGTGATGCTATTGC
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-Myo 1g was a gift from Martin Bähler (Addgene plasmid # 134991 ; http://n2t.net/addgene:134991 ; RRID:Addgene_134991)

  • For your References section:

    Myosin 1G (Myo1G) is a haematopoietic specific myosin that localises to the plasma membrane and regulates cell elasticity. Olety B, Walte M, Honnert U, Schillers H, Bahler M. FEBS Lett. 2010 Feb 5;584(3):493-9. doi: 10.1016/j.febslet.2009.11.096. Epub 2009 Dec 4. 10.1016/j.febslet.2009.11.096 PubMed 19968988
Related items:
Commonly requested with: