Skip to main content
Addgene

pAT1502-[PB-4xHSab-EF1a-Blast_2A_rtTA3-SV40pA(-)_pCW-DEST]
(Plasmid #134976)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134976 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCR8/GW/TOPO
  • Backbone size (bp) 11095
  • Vector type
    Mammalian Expression ; Gateway cloning
  • Promoter TET
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    ccdB Survival
  • Growth instructions
    Also has kanamycin resistance.
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer taggcgtgtacggtgggagg
  • 3′ sequencing primer tagaaggcacagtcgagg
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAT1502-[PB-4xHSab-EF1a-Blast_2A_rtTA3-SV40pA(-)_pCW-DEST] was a gift from Albert Cheng (Addgene plasmid # 134976)
  • For your References section:

    Enhanced CRISPR-based DNA demethylation by Casilio-ME-mediated RNA-guided coupling of methylcytosine oxidation and DNA repair pathways. Taghbalout A, Du M, Jillette N, Rosikiewicz W, Rath A, Heinen CD, Li S, Cheng AW. Nat Commun. 2019 Sep 20;10(1):4296. doi: 10.1038/s41467-019-12339-7. 10.1038/s41467-019-12339-7 PubMed 31541098