Myo 9 Avi+Flag
(Plasmid #134969)

• Purpose: Expression and purification of c.elegans Myo 9 (Hum 7) using baculovirus from pFastBac1
• Depositing Lab: Martin Bähler
• Publication: Liao et al J Biol Chem. 2010 Aug 6;285(32):24933-42. doi: 10.1074/jbc.M110.101105. Epub 2010 Jun 10.

Backbone

• Vector backbone: pFast Bac 1
• Backbone manufacturer: Invitrogen
• Backbone size w/o insert (bp): 4673
• Total vector size (bp): 10413
• Modifications to backbone: Avi and Flag tag
• Vector type: Insect Expression
• Selectable markers: Gentamicin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Myo 9
• Alt name: Hum 7, Myo IX
• Species: C. elegans (nematode)
• Insert Size (bp): 5740
• Entrez Gene: hum-7 (a.k.a. CELE_F56A6.2)
• Promoter: Polyhedrin
• Tags / Fusion Proteins:
  • Avi (C terminal on insert)
  • Flag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Bam HI (not destroyed)
• 3′ cloning site: Kpn I (not destroyed)
• 5′ sequencing primer: Polyhedrin forward AAATGATAACCATCTCGC
• 3′ sequencing primer: SV40pA-R GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Sequencing of the C. elegans Myo9 cDNA that was obtained by reverse transcription-PCR revealed that it differed from the HUM-7 amino acid sequence at two positions. Residues 608–615 (VSPISPFW) were missing, and residues 731KKSAG735 were replaced by 731KSESAG736. Our deduced Myo9 amino acid sequence changes matched perfectly with the predicted Myo9 sequences for Caenorhabditis briggsae and Caenorhabditis remanei.