Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pL40C_PGKintron_Cas9_Green
(Plasmid #134966)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134966 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    L40C
  • Backbone size w/o insert (bp) 7926
  • Total vector size (bp) 12951
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cas9-P2A-mNeonGreen
  • Species
    Streptococcus pyogenes
  • Promoter hPGK promoter with beta-globin intron
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer cccctctgctaaccatgttcatg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pL40C_PGKintron_Cas9_Green was derived by subcloning the hPGK promoter with beta-globin intron from Tet-pLKO-puro (Addgene #21915) into the L40C-CRISPR.EFS.mNeon.NL.SL vector (a gift from Dirk Heckl, Martin Luther University Halle-Wittenberg) using PacI and BamHI sites.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL40C_PGKintron_Cas9_Green was a gift from Beat Bornhauser (Addgene plasmid # 134966 ; http://n2t.net/addgene:134966 ; RRID:Addgene_134966)
  • For your References section:

    The Leukemogenic TCF3-HLF Complex Rewires Enhancers Driving Cellular Identity and Self-Renewal Conferring EP300 Vulnerability. Huang Y, Mouttet B, Warnatz HJ, Risch T, Rietmann F, Frommelt F, Ngo QA, Dobay MP, Marovca B, Jenni S, Tsai YC, Matzk S, Amstislavskiy V, Schrappe M, Stanulla M, Gstaiger M, Bornhauser B, Yaspo ML, Bourquin JP. Cancer Cell. 2019 Dec 9;36(6):630-644.e9. doi: 10.1016/j.ccell.2019.10.004. Epub 2019 Nov 14. 10.1016/j.ccell.2019.10.004 PubMed 31735627