Myo 9a-GFP R2166M
(Plasmid #134962)

• Purpose: Expression of rat Myo 9a (Myr 7) in mammalian cells.GAP minus mutant.
• Depositing Lab: Martin Bähler
• Publication: Chieregatti et al J Cell Sci. 1998 Dec 18;111 ( Pt 24):3597-608.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4719
• Total vector size (bp): 12684
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Myo 9a (rat) with 5' UTR. GAP minus mutant.
• Alt name: Myr 7
• Species: R. norvegicus (rat)
• Insert Size (bp): 7965
• Mutation: changed arginine 2166 to methionine
• GenBank ID:
• Entrez Gene: Myo9a
• Promoter: CMV IE
• Tag / Fusion Protein:
  • EGFP (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sac II (not destroyed)
• 3′ cloning site: Age I (not destroyed)
• 5′ sequencing primer: CMV Forward CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: EGFP-N CGTCGCCGTCCAGCTCGACCAG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: Plasmid contains a V2022I mutation in Myo 9a-GFP. This mutation is not a concern for plasmid function.