mcherry-Myo 9b R1695M
(Plasmid #134958)

• Purpose: Expression of rat Myo 9b (Myr 5) in mammalian cells.GAP minus mutant.
• Depositing Lab: Martin Bähler
• Publication: Hemkemeyer et al J Biol Chem. 2021 Jan-Jun;296:100136. doi: 10.1074/jbc.RA120.013623. Epub 2020 Dec 6.

Backbone

• Vector backbone: pmcherry-C1 (modified)
• Backbone manufacturer: Clontech (modified)
• Backbone size w/o insert (bp): 4652
• Total vector size (bp): 11501
• Modifications to backbone: pmcherry-C1 (Clontech), NT 597-612 and NT 1321-1329 are missing (no Eco 47 III, no Age I, no BspE I site).
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Myo 9b (rat) with 3' UTR. GAP minus mutant R1695M
• Alt name: Myr 5 R1695M
• Species: R. norvegicus (rat)
• Insert Size (bp): 6849
• Entrez Gene: Myo9b
• Promoter: CMV IE
• Tag / Fusion Protein:
  • mcherry (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho I (not destroyed)
• 3′ cloning site: Sma I (destroyed during cloning)
• 5′ sequencing primer: mcherry-F CCCCGTAATGCAGAAGAAGA
• 3′ sequencing primer: SV40pA-R GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please note: plasmid contains a T721I mutation in Myo9b. This mutation is not known to affect plasmid function.