GFP-Myo9b R1695M
(Plasmid #134911)

• Purpose: Expression of rat Myo 9b (Myr 5) in mammalian cells.GAP minus mutant.
• Depositing Lab: Martin Bähler
• Publication: Muller et al Mol Biol Cell. 1997 Oct;8(10):2039-53. doi: 10.1091/mbc.8.10.2039.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4686
• Total vector size (bp): 11535
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Myo 9b (rat) with 3' UTR. GAP minus mutant R1695M
• Alt name: Myr 5 R1695M
• Species: R. norvegicus (rat)
• Insert Size (bp): 6849
• Mutation: changed arginine 1695 to methionine
• Entrez Gene: Myo9b
• Promoter: CMV IE
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho I (not destroyed)
• 3′ cloning site: Sma I (destroyed during cloning)
• 5′ sequencing primer: EGFP-C CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: SV40pA-R GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

See also:
Van den Boom et al.
Molecular Biology of the Cell Vol. 18, No. 4, 1507-1518, April 2007
The Myosin IXb Motor Activity Targets the Myosin IXb RhoGAP Domain as Cargo to Sites of Actin Polymerization.
Published Online:21 Feb 2007https://doi.org/10.1091/mbc.e06-08-0771

Please note: Plasmid contains a T721I mutation in Myo9b. This mutation is not known to affect protein function.