Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pREP-8xARE-GFP-SV40-BFP
(Plasmid #134910)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134910 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pMIR
  • Vector type
    Mammalian Expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    8xARE- minimal promoter - GFP
  • Species
    Synthetic
  • Promoter 8xARE - minimal promoter

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site NdeI (not destroyed)
  • 5′ sequencing primer CGGATAACAATTTCACACAGG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    TagBFP
  • Species
    Synthetic
  • Promoter SV40

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site AflII (destroyed during cloning)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer none
  • 3′ sequencing primer CACTGCATTCTAGTTGTGGTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pREP-8xARE-GFP-SV40-BFP was a gift from Markus Landthaler (Addgene plasmid # 134910 ; http://n2t.net/addgene:134910 ; RRID:Addgene_134910)
  • For your References section:

    Single-cell RNA-sequencing of herpes simplex virus 1-infected cells connects NRF2 activation to an antiviral program. Wyler E, Franke V, Menegatti J, Kocks C, Boltengagen A, Praktiknjo S, Walch-Ruckheim B, Bosse J, Rajewsky N, Grasser F, Akalin A, Landthaler M. Nat Commun. 2019 Oct 25;10(1):4878. doi: 10.1038/s41467-019-12894-z. 10.1038/s41467-019-12894-z PubMed 31653857