Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pHRE
(Plasmid #134909)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134909 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHRE
  • Backbone size (bp) 10527
  • Modifications to backbone
    Removal of BsmB1, Sap1 and Bsa1 sites
  • Vector type
    Plant Expression, Synthetic Biology
  • Promoter double 35S
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    Clone and maintain in E. coli. For Expression in plants, transform Agrobacterium tumefaciens strain LBA4404 and grow at 28C.
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer caaccacaacgctctaacgc
  • 3′ sequencing primer gttctgtgaaggtgactgtactaacgc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHRE was a gift from George Lomonossoff (Addgene plasmid # 134909 ; http://n2t.net/addgene:134909 ; RRID:Addgene_134909)
  • For your References section:

    Improving plant transient expression through the rational design of synthetic 5' and 3' untranslated regions. Peyret H, Brown JKM, Lomonossoff GP. Plant Methods. 2019 Sep 18;15:108. doi: 10.1186/s13007-019-0494-9. eCollection 2019. 10.1186/s13007-019-0494-9 PubMed 31548848