Skip to main content
Addgene

pHREAC
(Plasmid #134908)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134908 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pHRE
  • Backbone size (bp) 10507
  • Modifications to backbone
    Removal of BsmB1, Sap1 and Bsa1 sites
  • Vector type
    Plant Expression, Synthetic Biology
  • Promoter double 35S
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Clone and maintain in E. coli. For Expression in plants, transform Agrobacterium tumefaciens strain LBA4404 and grow at 28C.
  • Copy number
    Low Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer caaccacaacgctctaacgc
  • 3′ sequencing primer ctgaagggacgacctgctaaacaggag
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHREAC was a gift from George Lomonossoff (Addgene plasmid # 134908 ; http://n2t.net/addgene:134908 ; RRID:Addgene_134908)

  • For your References section:

    Improving plant transient expression through the rational design of synthetic 5' and 3' untranslated regions. Peyret H, Brown JKM, Lomonossoff GP. Plant Methods. 2019 Sep 18;15:108. doi: 10.1186/s13007-019-0494-9. eCollection 2019. 10.1186/s13007-019-0494-9 PubMed 31548848
Related items:
Commonly requested with: