-
Purpose(Empty Backbone) Overexpression of recombinant proteins in plants thanks to very efficient translational efficiency. Empty vector, clone ORF using Bsa1 sites.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134908 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepHRE
- Backbone size (bp) 10507
-
Modifications to backboneRemoval of BsmB1, Sap1 and Bsa1 sites
-
Vector typePlant Expression, Synthetic Biology
- Promoter double 35S
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsClone and maintain in E. coli. For Expression in plants, transform Agrobacterium tumefaciens strain LBA4404 and grow at 28C.
-
Copy numberLow Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer caaccacaacgctctaacgc
- 3′ sequencing primer ctgaagggacgacctgctaaacaggag (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHREAC was a gift from George Lomonossoff (Addgene plasmid # 134908 ; http://n2t.net/addgene:134908 ; RRID:Addgene_134908) -
For your References section:
Improving plant transient expression through the rational design of synthetic 5' and 3' untranslated regions. Peyret H, Brown JKM, Lomonossoff GP. Plant Methods. 2019 Sep 18;15:108. doi: 10.1186/s13007-019-0494-9. eCollection 2019. 10.1186/s13007-019-0494-9 PubMed 31548848