GFP-Myo 9b
(Plasmid #134907)

• Purpose: Expression of rat Myo 9b (Myr 5) in mammalian cells.
• Depositing Lab: Martin Bähler
• Publication: Reinhard et al EMBO J. 1995 Feb 15;14(4):697-704.

Backbone

• Vector backbone: pEGFP-C1
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4686
• Total vector size (bp): 11535
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Myo 9b (rat) with 3' UTR
• Alt name: Myr 5
• Species: R. norvegicus (rat)
• Insert Size (bp): 6849
• GenBank ID: X77609
• Entrez Gene: Myo9b
• Promoter: CMV IE
• Tag / Fusion Protein:
  • EGFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Xho I (not destroyed)
• 3′ cloning site: Sma I (destroyed during cloning)
• 5′ sequencing primer: EGFP-C CATGGTCCTGCTGGAGTTCGTG
• 3′ sequencing primer: SV40pA-R GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

See also:
Van den Boom et al.
Molecular Biology of the Cell Vol. 18, No. 4, 1507-1518, April 2007
The Myosin IXb Motor Activity Targets the Myosin IXb RhoGAP Domain as Cargo to Sites of Actin Polymerization.
Published Online:21 Feb 2007https://doi.org/10.1091/mbc.e06-08-0771