pAT1089_PB-EF1a-Blast_2A_rtTA3-SV40pA_pCW-dCas9
(Plasmid
#134895)
-
PurposePiggyBac vector for establishement of doxycycline-inducible Sp dCas9 expression cell lines
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134895 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAT1502
- Backbone size w/o insert (bp) 11095
- Total vector size (bp) 13678
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHA-dCas9
-
SpeciesStreptococcus pyrogenes
-
Insert Size (bp)4508
- Promoter TET_ON (Dox inducible)
-
Tag
/ Fusion Protein
- HA-dCas9 (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer taggcgtgtacggtgggagg
- 3′ sequencing primer tagaaggcacagtcgagg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAT1089_PB-EF1a-Blast_2A_rtTA3-SV40pA_pCW-dCas9 was a gift from Albert Cheng (Addgene plasmid # 134895) -
For your References section:
Enhanced CRISPR-based DNA demethylation by Casilio-ME-mediated RNA-guided coupling of methylcytosine oxidation and DNA repair pathways. Taghbalout A, Du M, Jillette N, Rosikiewicz W, Rath A, Heinen CD, Li S, Cheng AW. Nat Commun. 2019 Sep 20;10(1):4296. doi: 10.1038/s41467-019-12339-7. 10.1038/s41467-019-12339-7 PubMed 31541098