Skip to main content
Addgene

pAT1089_PB-EF1a-Blast_2A_rtTA3-SV40pA_pCW-dCas9
(Plasmid #134895)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134895 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAT1502
  • Backbone size w/o insert (bp) 11095
  • Total vector size (bp) 13678
  • Vector type
    Mammalian Expression
  • Selectable markers
    Blasticidin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Kanamycin, 100 & 50 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HA-dCas9
  • Species
    Streptococcus pyrogenes
  • Insert Size (bp)
    4508
  • Promoter TET_ON (Dox inducible)
  • Tag / Fusion Protein
    • HA-dCas9 (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer taggcgtgtacggtgggagg
  • 3′ sequencing primer tagaaggcacagtcgagg
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAT1089_PB-EF1a-Blast_2A_rtTA3-SV40pA_pCW-dCas9 was a gift from Albert Cheng (Addgene plasmid # 134895)
  • For your References section:

    Enhanced CRISPR-based DNA demethylation by Casilio-ME-mediated RNA-guided coupling of methylcytosine oxidation and DNA repair pathways. Taghbalout A, Du M, Jillette N, Rosikiewicz W, Rath A, Heinen CD, Li S, Cheng AW. Nat Commun. 2019 Sep 20;10(1):4296. doi: 10.1038/s41467-019-12339-7. 10.1038/s41467-019-12339-7 PubMed 31541098