pLVX-EF1a-GalT-IRES-Puromycin
(Plasmid #134862)

• Purpose: Expresses EGFP-tagged Golgi marker
• Depositing Lab: David Andrews
• Publication: Schormann et al J Cell Biol. 2020 Mar 2;219(3). pii: 133635. doi: 10.1083/jcb.201904090.

Backbone

• Vector backbone: pLVX-EF1a-IRES-Puromycin
• Backbone size w/o insert (bp): 8825
• Total vector size (bp): 9807
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 30°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: beta 1,4-galactosyltransferase
• Species: H. sapiens (human)
• Insert Size (bp): 246
• Mutation: deleted amino acids 83-398
• Entrez Gene: B4GALT1 (a.k.a. B4GAL-T1, CDG2D, CLDLFIB, GGTB2, GT1, GTB, beta4Gal-T1)
• Promoter: EF1a
• Tag / Fusion Protein:
  • EGFP (C terminal on insert)

Cloning Information

• Cloning method: Unknown
• 5′ sequencing primer: ATGCGATGGAGTTTCCCCAC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: GalT sequence (1-246 bp) was subcloned from Clontech construct.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry