pAK_DR30_CasRx_Puro
(Plasmid
#134845)
-
PurposeAll in one overexpression of CasRx and guideRNA
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134845 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX459-Puro
-
Backbone manufacturerZhang Lab
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameRfxCas13d
-
Alt nameCasRx
-
Insert Size (bp)2898
- Promoter CAG
-
Tag
/ Fusion Protein
- T2A Puromycin (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer tttaagggatggttggttgg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPatrick Hsu Lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAK_DR30_CasRx_Puro was a gift from Michael Yaffe (Addgene plasmid # 134845 ; http://n2t.net/addgene:134845 ; RRID:Addgene_134845)