pAK_lentiguide_DR30_Puro
(Plasmid
#134839)
-
PurposeLentiviral expression CasRx guideRNA
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 134839 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonelentiguide-Puro
-
Backbone manufacturerZhang Lab
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCasRx guideRNA backbone
-
gRNA/shRNA sequenceempty
- Promoter hU6
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAGGGCCTATTTCCCATGATTCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPatrick Hsu Lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Insert gRNA with BsmBI digestion
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAK_lentiguide_DR30_Puro was a gift from Michael Yaffe (Addgene plasmid # 134839 ; http://n2t.net/addgene:134839 ; RRID:Addgene_134839)
