SMT205
(Plasmid #134817)

• Purpose: SMT201 with mutated RBS for DHFR, in vivo assays
• Depositing Lab: Tanja Kortemme
• Publication: Thompson et al Elife. 2020 Jul 23;9. pii: 53476. doi: 10.7554/eLife.53476.

Backbone

• Vector backbone: pACYC-Duet
• Backbone manufacturer: Novagen (EMD Millipore)
• Backbone size w/o insert (bp): 4008
• Total vector size (bp): 5180
• Modifications to backbone: T7 promoter has been replace with a TET promoter.
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol, 25 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: Dihydrofolate reductase
• Alt name: folA
• Species: Escherichia coli
• Insert Size (bp): 480
• Mutation: Silent mutations to eliminate internal restriction sites: S49, L62, S64, A81, I82, G97, K109, L110.
• GenBank ID: BAB96616.1
• Promoter: T7

Cloning Information for Gene/Insert 1

• Cloning method: Restriction Enzyme
• 5′ cloning site: NcoI (destroyed during cloning)
• 3′ cloning site: SalI (not destroyed)
• 5′ sequencing primer: GGATCTCGACGCTCTCCCTT
• 3′ sequencing primer: GATTATGCGGCCGTGTACAA

Gene/Insert 2

• Gene/Insert name: Thymidylate synthase
• Alt name: thyA
• Species: Escherichia coli
• Insert Size (bp): 807
• GenBank ID: BAE76896.1
• Promoter: TET

Cloning Information for Gene/Insert 2

• Cloning method: Restriction Enzyme
• 5′ cloning site: NdeI (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: TTGTACACGGCCGCATAATC
• 3′ sequencing primer: GCTAGTTATTGCTCAGCGG

Resource Information

• Supplemental Documents:
  • SMT205.ape
• A portion of this plasmid was derived from a plasmid made by: Modified from plasmids received from the laboratory of Professor Stephen Benkovic (Penn State University).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry