Skip to main content
Addgene

pLenti CMV Puro DHFR.cHSF1
(Plasmid #134739)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134739 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLenti CMV Puro Dest (w118-1)
  • Backbone manufacturer
    Eric Campeau, Paul Kaufman
  • Backbone size w/o insert (bp) 8022
  • Total vector size (bp) 10065
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DHFR.cHSF1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2043
  • Mutation
    Deletion of amino acids 186-202
  • GenBank ID
    NM_005526.4
  • Entrez Gene
    HSF1 (a.k.a. HSTF1)
  • Promoter CMV
  • Tag / Fusion Protein
    • DHFR (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer CATAGCGTAAAAGGAGCAACA
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti CMV Puro DHFR.cHSF1 was a gift from Matthew D. Shoulders (Addgene plasmid # 134739 ; http://n2t.net/addgene:134739 ; RRID:Addgene_134739)

  • For your References section:

    Host proteostasis modulates influenza evolution. Phillips AM, Gonzalez LO, Nekongo EE, Ponomarenko AI, McHugh SM, Butty VL, Levine SS, Lin YS, Mirny LA, Shoulders MD. Elife. 2017 Sep 26;6. doi: 10.7554/eLife.28652. 10.7554/eLife.28652 PubMed 28949290
Related items:
Commonly requested with: