pDest40 DHFR.dn-cHSF1
(Plasmid
#134735)
-
PurposeMammalian expression vector for constitutively active dominant-negative HSF1 fused to DHFR destabilized domain
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134735 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA DEST40
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5537
- Total vector size (bp) 7130
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDHFR.dn-cHSF1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1593
-
MutationDeletion of amino acids 186-202, 379−529
-
GenBank IDNM_005526.4
-
Entrez GeneHSF1 (a.k.a. HSTF1)
- Promoter CMV
-
Tag
/ Fusion Protein
- DHFR (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDest40 DHFR.dn-cHSF1 was a gift from Matthew D. Shoulders (Addgene plasmid # 134735 ; http://n2t.net/addgene:134735 ; RRID:Addgene_134735) -
For your References section:
Transportable, Chemical Genetic Methodology for the Small Molecule-Mediated Inhibition of Heat Shock Factor 1. Moore CL, Dewal MB, Nekongo EE, Santiago S, Lu NB, Levine SS, Shoulders MD. ACS Chem Biol. 2016 Jan 15;11(1):200-10. doi: 10.1021/acschembio.5b00740. Epub 2015 Nov 19. 10.1021/acschembio.5b00740 PubMed 26502114