Skip to main content
Addgene

pDest40 DHFR.dn-cHSF1
(Plasmid #134735)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134735 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pcDNA DEST40
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 5537
  • Total vector size (bp) 7130
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DHFR.dn-cHSF1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1593
  • Mutation
    Deletion of amino acids 186-202, 379−529
  • GenBank ID
    NM_005526.4
  • Entrez Gene
    HSF1 (a.k.a. HSTF1)
  • Promoter CMV
  • Tag / Fusion Protein
    • DHFR (N terminal on insert)

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer TAGAAGGCACAGTCGAGG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDest40 DHFR.dn-cHSF1 was a gift from Matthew D. Shoulders (Addgene plasmid # 134735 ; http://n2t.net/addgene:134735 ; RRID:Addgene_134735)
  • For your References section:

    Transportable, Chemical Genetic Methodology for the Small Molecule-Mediated Inhibition of Heat Shock Factor 1. Moore CL, Dewal MB, Nekongo EE, Santiago S, Lu NB, Levine SS, Shoulders MD. ACS Chem Biol. 2016 Jan 15;11(1):200-10. doi: 10.1021/acschembio.5b00740. Epub 2015 Nov 19. 10.1021/acschembio.5b00740 PubMed 26502114