pMXs-Ascl1
(Plasmid
#134671)
-
PurposeRetroviral expression of mouse Ascl1
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134671 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepMXs
-
Backbone manufacturerDr. Toshio Kitamura of the University of Tokyo, the Institute of Medical Science
-
Vector typeRetroviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameAscl1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)696
-
Entrez GeneAscl1 (a.k.a. ASH1, Mash1, bHLHa46)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer caccatggagagctctggcaagatg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMXs-Ascl1 was a gift from Marius Wernig (Addgene plasmid # 134671 ; http://n2t.net/addgene:134671 ; RRID:Addgene_134671) -
For your References section:
Generation of functional human oligodendrocytes from dermal fibroblasts by direct lineage conversion. Tanabe K, Nobuta H, Yang N, Ang CE, Huie P, Jordan S, Oldham MC, Rowitch DH, Wernig M. Development. 2022 Oct 15;149(20). pii: 275808. doi: 10.1242/dev.199723. Epub 2022 Jun 24. 10.1242/dev.199723 PubMed 35748297