-
PurposeCRISPR delivery and repair template delivery vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134660 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepWS3
-
Backbone manufacturerWillem van Schaik
- Backbone size w/o insert (bp) 4172
- Total vector size (bp) 4822
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Spectinomycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Escherichia coli EC1000
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCRISPR guide RNA array
-
Insert Size (bp)650
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer AAAACTCGAGCCACTCACCATGGGTACTGCAG
- 3′ sequencing primer AAAAGAATTCAACGTTGGCGATTCGTTGGCGATTGA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that this plasmid may require a unique bacterial strain, so make sure to confirm that you can also obtain the appropriate growth strain. Please contact us at [email protected] or contact our distributors if you have any questions.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pVDM1001 was a gift from Willem van Schaik (Addgene plasmid # 134660 ; http://n2t.net/addgene:134660 ; RRID:Addgene_134660) -
For your References section:
CRISPR-Cas9-mediated genome editing in vancomycin-resistant Enterococcus faecium. de Maat V, Stege PB, Dedden M, Hamer M, van Pijkeren JP, Willems RJL, van Schaik W. FEMS Microbiol Lett. 2019 Nov 1;366(22). pii: 5697197. doi: 10.1093/femsle/fnz256. 10.1093/femsle/fnz256 PubMed 31905238