-
PurposeFlag and GFP-tagged OSBP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 134659 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepLJM1
- Backbone size w/o insert (bp) 8136
- Total vector size (bp) 10560
-
Modifications to backboneThe original EGFP was removed, and FLAG-GFP was inserted at AgeI and Sall sites, followed by OSBP at Sall and blunted EcoRI sites into the pLJM1 backbone.
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameOSBP
-
Alt nameOxysterol-binding protein 1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2424
-
GenBank IDNM_002556.3
-
Entrez GeneOSBP (a.k.a. OSBP1)
-
Tags
/ Fusion Proteins
- FLAG (N terminal on backbone)
- GFP (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Sall (not destroyed)
- 3′ cloning site EcoRI (destroyed during cloning)
- 5′ sequencing primer GCAAATGGGCGGTAGGCG
- 3′ sequencing primer CTTTAGTTTGTATGTCTGTTGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byOSBP sequence was synthesized by Gene Blocks and codon-optimized.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLJM1-FLAG-GFP-OSBP was a gift from Roberto Zoncu (Addgene plasmid # 134659 ; http://n2t.net/addgene:134659 ; RRID:Addgene_134659) -
For your References section:
ER-lysosome contacts enable cholesterol sensing by mTORC1 and drive aberrant growth signalling in Niemann-Pick type C. Lim CY, Davis OB, Shin HR, Zhang J, Berdan CA, Jiang X, Counihan JL, Ory DS, Nomura DK, Zoncu R. Nat Cell Biol. 2019 Oct;21(10):1206-1218. doi: 10.1038/s41556-019-0391-5. Epub 2019 Sep 23. 10.1038/s41556-019-0391-5 PubMed 31548609