Skip to main content
Addgene

pLJM1-FLAG-GFP-OSBP
(Plasmid #134659)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134659 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pLJM1
  • Backbone size w/o insert (bp) 8136
  • Total vector size (bp) 10560
  • Modifications to backbone
    The original EGFP was removed, and FLAG-GFP was inserted at AgeI and Sall sites, followed by OSBP at Sall and blunted EcoRI sites into the pLJM1 backbone.
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OSBP
  • Alt name
    Oxysterol-binding protein 1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    2424
  • GenBank ID
    NM_002556.3
  • Entrez Gene
    OSBP (a.k.a. OSBP1)
  • Tags / Fusion Proteins
    • FLAG (N terminal on backbone)
    • GFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Sall (not destroyed)
  • 3′ cloning site EcoRI (destroyed during cloning)
  • 5′ sequencing primer GCAAATGGGCGGTAGGCG
  • 3′ sequencing primer CTTTAGTTTGTATGTCTGTTGC
    • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    OSBP sequence was synthesized by Gene Blocks and codon-optimized.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJM1-FLAG-GFP-OSBP was a gift from Roberto Zoncu (Addgene plasmid # 134659 ; http://n2t.net/addgene:134659 ; RRID:Addgene_134659)

  • For your References section:

    ER-lysosome contacts enable cholesterol sensing by mTORC1 and drive aberrant growth signalling in Niemann-Pick type C. Lim CY, Davis OB, Shin HR, Zhang J, Berdan CA, Jiang X, Counihan JL, Ory DS, Nomura DK, Zoncu R. Nat Cell Biol. 2019 Oct;21(10):1206-1218. doi: 10.1038/s41556-019-0391-5. Epub 2019 Sep 23. 10.1038/s41556-019-0391-5 PubMed 31548609
Related items:
Commonly requested with: