pLJM1-Lyso-FLAG-GFP-Sac1-Cat-WT
(Plasmid #134645)

• Purpose: lysosome-targeted Sac1 catalytic domain wild type
• Depositing Lab: Roberto Zoncu
• Publication: Lim et al Nat Cell Biol. 2019 Oct;21(10):1206-1218. doi: 10.1038/s41556-019-0391-5. Epub 2019 Sep 23.

Backbone

• Vector backbone: pLJM1
• Backbone size w/o insert (bp): 8283
• Total vector size (bp): 9618
• Modifications to backbone: The original EGFP was removed, and Lyso-FLAG-GFP was inserted at AgeI and Sall sites, followed by Sac1-cat-WT at Sall and EcoRI sites into the pLJM1 vector.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Sac1 catalytic domain (77-520 aa)
• Species: H. sapiens (human)
• Insert Size (bp): 1335
• Mutation: contains only amino acids 77-520 (Please see depositor comments below)
• Entrez Gene: SACM1L (a.k.a. SAC1)
• Tags / Fusion Proteins:
  • lysosomal-tag (p18 N-terminal 1-39aa) (N terminal on backbone)
  • FLAG (N terminal on backbone)
  • GFP (N terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: Sall (not destroyed)
• 3′ cloning site: EcoRI (destroyed during cloning)
• 5′ sequencing primer: GCAAATGGGCGGTAGGCG
• 3′ sequencing primer: CTTTAGTTTGTATGTCTGTTGC

Resource Information

• Supplemental Documents:
  • pljm1-lyso-flag-gfp-sac1-cat-wt.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

https://benchling.com/s/seq-qxhV9zfCgjMsG57hRPgZ

There is a single mutation in Sac1 - Y668F (based on entire insert reading frame) that the depositor confirms does not affect function. This is likely a random mutation introduced by the gene block synthesis process.