Skip to main content
Addgene

px330-RPL26 sgRNA1
(Plasmid #134641)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134641 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    RPL26 sgRNA2
  • gRNA/shRNA sequence
    TGCCCTTTTCCTTTCCTACT
  • Species
    H. sapiens (human)
  • Entrez Gene
    RPL26 (a.k.a. DBA11, L26)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px330-RPL26 sgRNA1 was a gift from Yihong Ye (Addgene plasmid # 134641 ; http://n2t.net/addgene:134641 ; RRID:Addgene_134641)

  • For your References section:

    UFMylation of RPL26 links translocation-associated quality control to endoplasmic reticulum protein homeostasis. Wang L, Xu Y, Rogers H, Saidi L, Noguchi CT, Li H, Yewdell JW, Guydosh NR, Ye Y. Cell Res. 2020 Jan;30(1):5-20. doi: 10.1038/s41422-019-0236-6. Epub 2019 Oct 8. 10.1038/s41422-019-0236-6 PubMed 31595041
Related items:
Commonly requested with: