Skip to main content
Addgene

px330-UFL1 sgRNA1
(Plasmid #134635)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 134635 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    UFL1 sgRNA1
  • gRNA/shRNA sequence
    CGGACGCCTGGGAAGAGATT
  • Species
    H. sapiens (human)
  • Entrez Gene
    UFL1 (a.k.a. KIAA0776, Maxer, NLBP, RCAD)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    px330-UFL1 sgRNA1 was a gift from Yihong Ye (Addgene plasmid # 134635 ; http://n2t.net/addgene:134635 ; RRID:Addgene_134635)
  • For your References section:

    UFMylation of RPL26 links translocation-associated quality control to endoplasmic reticulum protein homeostasis. Wang L, Xu Y, Rogers H, Saidi L, Noguchi CT, Li H, Yewdell JW, Guydosh NR, Ye Y. Cell Res. 2020 Jan;30(1):5-20. doi: 10.1038/s41422-019-0236-6. Epub 2019 Oct 8. 10.1038/s41422-019-0236-6 PubMed 31595041