pLJM1-Tmem192-mRFP-3xHA
(Plasmid #134631)

• Purpose: bait for affinity-isolation of lysosomes
• Depositing Lab: Roberto Zoncu
• Publication: Lim et al Nat Cell Biol. 2019 Oct;21(10):1206-1218. doi: 10.1038/s41556-019-0391-5. Epub 2019 Sep 23.

Backbone

• Vector backbone: pLJM1
• Backbone size w/o insert (bp): 8143
• Total vector size (bp): 8956
• Modifications to backbone: The original EGFP was removed, and Tmem192-mRFP-3xHA was inserted at NheI and EcoRI sites into the pLJM1 backbone.
• Vector type: Mammalian Expression, Lentiviral
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TMEM192
• Species: H. sapiens (human)
• Insert Size (bp): 813
• Entrez Gene: TMEM192
• Tags / Fusion Proteins:
  • mRFP (C terminal on backbone)
  • TEV (C terminal on backbone)
  • 3xHA (C terminal on backbone)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: NheI (not destroyed)
• 3′ cloning site: EcoRI (not destroyed)
• 5′ sequencing primer: GCAAATGGGCGGTAGGCG
• 3′ sequencing primer: CTTTAGTTTGTATGTCTGTTGC

Resource Information

• Addgene Notes:
  • Addgene Diagnostic Digest
  • Addgene Diagnostic Digest
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

https://benchling.com/s/seq-RvUzzEZYODnpIqZ8ije9